About PolyMarker

PolyMarker is an automated bioinformatics pipeline for SNP assay development which increases the probability of generating homoeologue-specific assays for polyploid wheat. PolyMarker generates a multiple alignment between the target SNP sequence and the IWGSC chromosome survey sequences (IWGSC, 2014 ) for each of the three wheat genomes. It then generates a mask with informative positions which are highlighted with respect to the target genome.

These positions include (see figure for example):

PolyMarker will generate KASP assays (read more) which are based on a three primer system. Two diagnostic primers incorporate the alternative varietal SNP at the 3' end, but are otherwise similar (black boxed primers in figure). The third common primer is preferentially selected to incorporate a genome-specific base at the 3' end (red boxed primer in figure), or a semi-specific base in the absence of an adequate genome specific position.

The code of the PolyMarker pipeline is available in github.

Using PolyMarker

Example

Input file

The example input file contains three markers to design.

Gene_1,6B,GATAAGCGATGACGATACGGACGACA[A/T]ACGGGGGACGAGGGATACGAT 
Gene_2,2A,CGATAGCATAGCATGGCGTTAGCAGT[G/C]TAGTACGATAGATCAGTACGA 
Ta#S58861868,1A,CATACTGATGACACGATTGGCTACSGGCCTTGAAGATAGMAGCAGAT[A/G]ACTTCAGTGTAATCCAAGTTGACTG

Output: mask

The mask contains the details of the local alignment

Mask diagram